Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

avatar
laperla
Bocachánclez

Mensajes : 9541
Debut oficial : 20/10/2009

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por laperla el Dom 10 Jul 2011 - 14:58

Metropolitano escribió:
Raifol escribió:http://www.as.com/opinion/articulo/manzano-debe-buscar-champions/20110704dasdaiopi_6/Tes

El Atlético dilapidó en una campaña todo el crédito cosechado con el bicampeonato europeo.

En este caso es un viejo conocido, Manzano, que tiene la ilusión de un niño en su segunda etapa al frente del equipo madrileño

A pesar de todo, el Atlético arranca con la fuerza y las expectativas de un grande. Por ejemplo con las incorporaciones de Gabi, Sílvio, Salvio, Miranda y la más que probable de Adrián


jajajajaja....

Madre mía.. De donde sacan a estos periodistas? Son vecarios?

O eso o en las ruedas de prensa les meten información subliminal y les comen el coco.. vamos yo no me lo explico... Ni el Mallorca estaría ilusionado con estos fichajes... NI EL MALLORCA..
face

miranda : central 1984, 6 veces internacional con brasil, considerado el jugador con mejor rendimiento del sao paulo fc en 2010 (el sao paulo es tres veces campeon mundial en los ultimos 20 años)

silvio : defensa polivalente 1987, seguramente el mejor y mas regular jugador del sporting braga, equipo revelacion en europa la ultima temporada. Internacional con portugal desde septiembre del 2010, de momento suplente de joao pereira que bento tuvo a sus ordenes en el sporting y que de momento esta respondiendo bien a su confianza.

gabi : mediocentro 1983, para muchos el jugador lider del zaragoza en la pasada temporada

salvio : extremo derecho 1990, destaco muy joven en el futbol argentino, no cuajo mucho aunque sin jugar mucho en su primera mitad de temporada en el atletico, viene de una gran temporada en el benfica donde ha sido el mejor del equipo con coentrao. El benfica acuso mucho su ausencia en semis de vuelta de la copa de portugal frente a porto y en semis de la uefa frente al braga

adrian 1988 : una de las mayores esperanzas del futbol español como delantero, grandes referencias en las categoias inferiores de la seleccion, en primera le ha costado mas cuajar yrendir con regularidad, sin embargo su ultima temporada ha sido su mejor temoada en primera, ha hecho partidos muy buenos, y lo ha coronado siendo pichichi y elegido mvp del reciente europeo sub21

ventas : de gea, se supone que aguero puede salir, pero que tambien su salida implicaria la llegada de otros jugadores
vamos yo creo que los aficionados de cualquier equipo de la liga salvo madrid o barcelona darian palmas con las orejas con esos fichajes...
masoquismo ??
Metropolitano
Metropolitano
Su Campechana Majestad

Mensajes : 19867
Edad : 45
Localización : Madrid
Debut oficial : 14/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Metropolitano el Lun 11 Jul 2011 - 2:24

Miranda: Defensa Central. 6 veces internacional por brasil...

Defensas centrales del Málaga C.F:
- Demichelis: 21 veces internacional por Argentina. Ganador de 4 Bundesligas.
- Mathijsen: 72 veces internacional por Holanda.

Defensas centrales del del RCD. Español:
- Hector Moreno: 23 años. 18 veces internacional por México.
- Juan Forlín: 23 años. Internacional con Argentina.

Defensas Centrales del Getafe:
- Manuel "Cata" Diaz: 12 veces internacional con Argentina.
- Michelangelo Albertazzi: 20 años. Cedido por el Milan. Internacional Italiano Sub. 16, Sub. 17, Sub. 19 y Sub. 20. Sub-campeon de Europa Sub. 19.


Y ni he mirado Valencia, Villareal y Sevilla... SIGO?


Gabi: Medicocentro.. Lider del Zaragoza que está a punto de descender.. Fracaso una y dos veces en el Atletico de Madrid, vuelve una tercera vez a ver si suena la flauta. Un jugador que NO ES INTERNACIONAL.. Por el que el Atletico de Madrid ha pagado.. 3 millones de Euros.. Cuando el Málaga ficha a Isco al Valencia por 6..

Silvio: Defensa polivalente (Como Perea, mira por donde).. El Mejor jugador "de todos los tiempos" del Sporting de Braga si quieres. Menos internacional que Pablo o que Juanito (Jugadores recientes en nuestra plantilla). Es un buen jugador como los hay DECENAS en la Liga Española.

Adrian: Unico fichaje de esta temporada a la altura de un Atletico de Madrid que aspire a ser grande algun día.. Y todavía no está firmado.

Salvio: No es fichaje. No está confirmado que se quede.


Crees que debemos ilusionarnos porque piensas que el Aletico de Madrid es un club de media tabla y que tiene que conformarse con no pasar de ahí en los proximos 20 años... En cualquier otro caso... NO ME LO EXPLICO.
Don limpio
Don limpio
Cruciquense

Mensajes : 32811
Localización : En tu armario de la limpieza
Debut oficial : 28/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Don limpio el Lun 11 Jul 2011 - 23:36

laperla escribió:
Metropolitano escribió:


jajajajaja....

Madre mía.. De donde sacan a estos periodistas? Son vecarios?

O eso o en las ruedas de prensa les meten información subliminal y les comen el coco.. vamos yo no me lo explico... Ni el Mallorca estaría ilusionado con estos fichajes... NI EL MALLORCA..
face

miranda : central 1984, 6 veces internacional con brasil, considerado el jugador con mejor rendimiento del sao paulo fc en 2010 (el sao paulo es tres veces campeon mundial en los ultimos 20 años)

silvio : defensa polivalente 1987, seguramente el mejor y mas regular jugador del sporting braga, equipo revelacion en europa la ultima temporada. Internacional con portugal desde septiembre del 2010, de momento suplente de joao pereira que bento tuvo a sus ordenes en el sporting y que de momento esta respondiendo bien a su confianza.

gabi : mediocentro 1983, para muchos el jugador lider del zaragoza en la pasada temporada

salvio : extremo derecho 1990, destaco muy joven en el futbol argentino, no cuajo mucho aunque sin jugar mucho en su primera mitad de temporada en el atletico, viene de una gran temporada en el benfica donde ha sido el mejor del equipo con coentrao. El benfica acuso mucho su ausencia en semis de vuelta de la copa de portugal frente a porto y en semis de la uefa frente al braga

adrian 1988 : una de las mayores esperanzas del futbol español como delantero, grandes referencias en las categoias inferiores de la seleccion, en primera le ha costado mas cuajar yrendir con regularidad, sin embargo su ultima temporada ha sido su mejor temoada en primera, ha hecho partidos muy buenos, y lo ha coronado siendo pichichi y elegido mvp del reciente europeo sub21

ventas : de gea, se supone que aguero puede salir, pero que tambien su salida implicaria la llegada de otros jugadores
vamos yo creo que los aficionados de cualquier equipo de la liga salvo madrid o barcelona darian palmas con las orejas con esos fichajes...
masoquismo ??
Que nivelazo. Estamos todos asustados del potencial de estos fichajes. Si terminan de fichar a Osvaldo y Lafita creo que nos dan el puesto Champion para la temporada siguiente, sin jugar.
deyvid_atletico
deyvid_atletico
Cruciquito
Cruciquito

Mensajes : 28756
Debut oficial : 13/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por deyvid_atletico el Lun 11 Jul 2011 - 23:50

Don limpio escribió:
laperla escribió:
face

miranda : central 1984, 6 veces internacional con brasil, considerado el jugador con mejor rendimiento del sao paulo fc en 2010 (el sao paulo es tres veces campeon mundial en los ultimos 20 años)

silvio : defensa polivalente 1987, seguramente el mejor y mas regular jugador del sporting braga, equipo revelacion en europa la ultima temporada. Internacional con portugal desde septiembre del 2010, de momento suplente de joao pereira que bento tuvo a sus ordenes en el sporting y que de momento esta respondiendo bien a su confianza.

gabi : mediocentro 1983, para muchos el jugador lider del zaragoza en la pasada temporada

salvio : extremo derecho 1990, destaco muy joven en el futbol argentino, no cuajo mucho aunque sin jugar mucho en su primera mitad de temporada en el atletico, viene de una gran temporada en el benfica donde ha sido el mejor del equipo con coentrao. El benfica acuso mucho su ausencia en semis de vuelta de la copa de portugal frente a porto y en semis de la uefa frente al braga

adrian 1988 : una de las mayores esperanzas del futbol español como delantero, grandes referencias en las categoias inferiores de la seleccion, en primera le ha costado mas cuajar yrendir con regularidad, sin embargo su ultima temporada ha sido su mejor temoada en primera, ha hecho partidos muy buenos, y lo ha coronado siendo pichichi y elegido mvp del reciente europeo sub21

ventas : de gea, se supone que aguero puede salir, pero que tambien su salida implicaria la llegada de otros jugadores
vamos yo creo que los aficionados de cualquier equipo de la liga salvo madrid o barcelona darian palmas con las orejas con esos fichajes...
masoquismo ??
Que nivelazo. Estamos todos asustados del potencial de estos fichajes. Si terminan de fichar a Osvaldo y Lafita creo que nos dan el puesto Champion para la temporada siguiente, sin jugar.

Es acojonante,pero al menos elperla ha entrado a exponer argumentos de forma educada.
Da pena,pero los aficionados de otros equipos (principalmente del Barça y Madrid) ven al Atlético como un Getafe cualquiera y consideran cualquier mediania un buen fichaje........PARA EL ATLETI!!!!
Eso si,si les fichan a ellos algo similar primero le proclaman futuro balón de oro y en dos semanas le mandan al vertedero Laughing
Don limpio
Don limpio
Cruciquense

Mensajes : 32811
Localización : En tu armario de la limpieza
Debut oficial : 28/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Don limpio el Mar 12 Jul 2011 - 1:28

Lo que hemos fichado son jugadores mediocres. Mejores o peores, son jugadores de relleno y en algun caso de titular, pero no para despuntar. Y lo que necesita el Atletico son jugadores de nivel, especialmente, en el centro del campo. Ojo, y no me parecen malos fichajes. Al unico fichaje al que me niego es al de Gabi. Primero, me parece ridiculo ficharlo y segundo que sin salir Raul Garcia, no tiene cabida en el equipo. Luego Miranda tampoco me gusta, y buscaria a Botia (por ejem) pero vamos, ha salido gratis y como tercer central no es una locura.

Pero esto no es suficiente, y no trago con la cantinela de los pseudo expertos, diciendome que me la tendria que pelar con estos jugadores, cuando llegan muy justitutos para el nivel que se "presupone".


PD: Salvio no es un fichaje. Ademas ni es seguro que continue en el equipo, es mas, yo diria que esta hecho por el Benfica.
JoGv2.0
JoGv2.0
Cruciquense

Mensajes : 37939
Edad : 37
Debut oficial : 26/03/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por JoGv2.0 el Mar 12 Jul 2011 - 11:35

A mi lo que me teneis que explicar es, con todos los pufos que han salido a la luz, con la gestión espectacular y con las expectativas de un grande ( Laughing hay que joderse ), se renuevan un 91% de abonos.

Yo me esperaba algún tipo de castigo en ese sentido. Un castigo relevante, quiero decir, llamativo.

Al final todas las aficiones futboleras parecen estar regidas por la estupidez ( me refiero a la parte de ellas que "financia" a sus clubes ).
avatar
laperla
Bocachánclez

Mensajes : 9541
Debut oficial : 20/10/2009

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por laperla el Mar 12 Jul 2011 - 13:16

entiendo que la aficion del atletico lleva mucho tiempo llevandose decepciones
pero tener por ello una actitud negativa con sus jugadores y los fichajes por sistema es pegarse un tiro en el pie
que en otro momento cosas se hayan hecho o hayan salido mal no signfica que tenga ques er asi siempre

salvio lo considero un fichaje, un refuerzo o como se le quiera llamar porque la temporada pasada no estaba en el equipo
no creo que el benfica lo compre porque ha gastado unos millones en enzo perez
me parece un jugador que puede aportar mucho el atletico

la delantera con salvio aguero adrian reyes y juanfran para tres posiciones me parece muy buena
sin contar a forlan porque esta muy mal, pero si no es vendido, siempre puede resurgir, quien tuvo retuvo

silvio es muy buen jugador, la pareja silvio-filipe luis, me parece un lujo de equipo grande (con equipo grande me refiero a los equipos conaspiraciones en champions). Los recambios son de nivel justito

miranda es un central bueno, para mi a dia de hoy sin duda mejor que cualquiera de los que el atletico tiene, por lo tanto tambien mejora por alli el atleti

la porteria es una incognita

el centro del campo no es para tirar cohetes, pero con suarez elias koke tiago para tres puestos, creo que minimo la mitad de equipos de la liga se darian con un canto en los dientes con ese elenco
falta la guinda de un centrocampista ofensivo de primer nivel.

En general me parece quizas la mejor plantilla que le recuerdo al atletico, mas si viene el mencionado centrocampista ofensivo

claro esta que si luego no estan ni salvio ni aguero ni el centrocampista y el portero resulta ser malo, es otra historia

el atleti ya tuvo un buen final de temporada, con las aportaciones de juanfran costa y elias/koke, que no se olvide
con los nuevos si al final la plantilla es esa solo puede mejorar aun ese buen estado de final de temporada

teniendo en cuenta el estado economico del atletico y que no juega champions tampoco esta temporada, la vision negativa en estos momentos de los fichajes me parece muy erronea.
Metropolitano
Metropolitano
Su Campechana Majestad

Mensajes : 19867
Edad : 45
Localización : Madrid
Debut oficial : 14/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Metropolitano el Mar 12 Jul 2011 - 15:29

laperla escribió:entiendo que la aficion del atletico lleva mucho tiempo llevandose decepciones
pero tener por ello una actitud negativa con sus jugadores y los fichajes por sistema es pegarse un tiro en el pie
que en otro momento cosas se hayan hecho o hayan salido mal no signfica que tenga ques er asi siempre

salvio lo considero un fichaje, un refuerzo o como se le quiera llamar porque la temporada pasada no estaba en el equipo
no creo que el benfica lo compre porque ha gastado unos millones en enzo perez
me parece un jugador que puede aportar mucho el atletico

la delantera con salvio aguero adrian reyes y juanfran para tres posiciones me parece muy buena
sin contar a forlan porque esta muy mal, pero si no es vendido, siempre puede resurgir, quien tuvo retuvo

silvio es muy buen jugador, la pareja silvio-filipe luis, me parece un lujo de equipo grande (con equipo grande me refiero a los equipos conaspiraciones en champions). Los recambios son de nivel justito

miranda es un central bueno, para mi a dia de hoy sin duda mejor que cualquiera de los que el atletico tiene, por lo tanto tambien mejora por alli el atleti

la porteria es una incognita

el centro del campo no es para tirar cohetes, pero con suarez elias koke tiago para tres puestos, creo que minimo la mitad de equipos de la liga se darian con un canto en los dientes con ese elenco
falta la guinda de un centrocampista ofensivo de primer nivel.

En general me parece quizas la mejor plantilla que le recuerdo al atletico, mas si viene el mencionado centrocampista ofensivo

claro esta que si luego no estan ni salvio ni aguero ni el centrocampista y el portero resulta ser malo, es otra historia

el atleti ya tuvo un buen final de temporada, con las aportaciones de juanfran costa y elias/koke, que no se olvide
con los nuevos si al final la plantilla es esa solo puede mejorar aun ese buen estado de final de temporada

teniendo en cuenta el estado economico del atletico y que no juega champions tampoco esta temporada, la vision negativa en estos momentos de los fichajes me parece muy erronea.


No es visión negativa... Es que, por ejemplo, decir que Miranda mejora a Godín es demasiado "optimismo"...

El centro del campo con Elias, Tiago, Gabi, Koke y M. Suarez me parece digno de un equipo "malillo" de la Liga.. De hecho si me pongo a comparar probablemente estemos entre los 8 peores centros del campo de la Liga.. El único que pone calidad es Koke (que todavía es muy joven para que se note) y Tiago a medias.. Estamos muy lejos del de los equipos que competimos (Villareal, Sevilla.. Incluso Athetic y Málaga, que ya se unen a este carro). Y no sabes lo jodido que es para un seguidor del Atleti decir que su rival es el Málaga... YA ME CONTARÁS... El centro del campo es la demarcación que más influencia tiene en un equipo de futbol... El pilar básico.. Y este centro del campo NO NOS SUJETA... Para nada...

Yo en la portería no tengo ninguna duda... tenemos dos porteros buenos.

La defensa es buena (Si no se va Godín), aqui si hemos progresado en comparación con hace 2 o 3 años bastante..

Y la delantera depende de todos los lios que hay.. Si se va Aguero, independientemente del que venga, perdemos nivel.. Si se va Forlán que, aunque espero que lo haga, perderiamos gol... Y no se que pasará al final con Adrian... Pero una delantera con Juanfran, Salvio, Reyes, Adrian y Aguero.. Salvo por Juanfran, me gusta.. Claro que que posibilidades hay de que esto pase? MUY POCAS...


No soy pesimista (Y estoy seguro de que aquí te dirán de mi lo contrario), es simplemente que los fichajes son mediocres, a la altura de lo que estamos haciendo habitualmente... Fichar medianias... Ya te digo que el único que Ilusiona es Adrian y todavía no está fichado y Salvio que puede aportar cositas... Lo demás es regular o malo...
deyvid_atletico
deyvid_atletico
Cruciquito
Cruciquito

Mensajes : 28756
Debut oficial : 13/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por deyvid_atletico el Mar 12 Jul 2011 - 18:08

Metropolitano escribió:
laperla escribió:entiendo que la aficion del atletico lleva mucho tiempo llevandose decepciones
pero tener por ello una actitud negativa con sus jugadores y los fichajes por sistema es pegarse un tiro en el pie
que en otro momento cosas se hayan hecho o hayan salido mal no signfica que tenga ques er asi siempre

salvio lo considero un fichaje, un refuerzo o como se le quiera llamar porque la temporada pasada no estaba en el equipo
no creo que el benfica lo compre porque ha gastado unos millones en enzo perez
me parece un jugador que puede aportar mucho el atletico

la delantera con salvio aguero adrian reyes y juanfran para tres posiciones me parece muy buena
sin contar a forlan porque esta muy mal, pero si no es vendido, siempre puede resurgir, quien tuvo retuvo

silvio es muy buen jugador, la pareja silvio-filipe luis, me parece un lujo de equipo grande (con equipo grande me refiero a los equipos conaspiraciones en champions). Los recambios son de nivel justito

miranda es un central bueno, para mi a dia de hoy sin duda mejor que cualquiera de los que el atletico tiene, por lo tanto tambien mejora por alli el atleti

la porteria es una incognita

el centro del campo no es para tirar cohetes, pero con suarez elias koke tiago para tres puestos, creo que minimo la mitad de equipos de la liga se darian con un canto en los dientes con ese elenco
falta la guinda de un centrocampista ofensivo de primer nivel.

En general me parece quizas la mejor plantilla que le recuerdo al atletico, mas si viene el mencionado centrocampista ofensivo

claro esta que si luego no estan ni salvio ni aguero ni el centrocampista y el portero resulta ser malo, es otra historia

el atleti ya tuvo un buen final de temporada, con las aportaciones de juanfran costa y elias/koke, que no se olvide
con los nuevos si al final la plantilla es esa solo puede mejorar aun ese buen estado de final de temporada

teniendo en cuenta el estado economico del atletico y que no juega champions tampoco esta temporada, la vision negativa en estos momentos de los fichajes me parece muy erronea.


No es visión negativa... Es que, por ejemplo, decir que Miranda mejora a Godín es demasiado "optimismo"...

El centro del campo con Elias, Tiago, Gabi, Koke y M. Suarez me parece digno de un equipo "malillo" de la Liga.. De hecho si me pongo a comparar probablemente estemos entre los 8 peores centros del campo de la Liga.. El único que pone calidad es Koke (que todavía es muy joven para que se note) y Tiago a medias.. Estamos muy lejos del de los equipos que competimos (Villareal, Sevilla.. Incluso Athetic y Málaga, que ya se unen a este carro). Y no sabes lo jodido que es para un seguidor del Atleti decir que su rival es el Málaga... YA ME CONTARÁS... El centro del campo es la demarcación que más influencia tiene en un equipo de futbol... El pilar básico.. Y este centro del campo NO NOS SUJETA... Para nada...

Yo en la portería no tengo ninguna duda... tenemos dos porteros buenos.

La defensa es buena (Si no se va Godín), aqui si hemos progresado en comparación con hace 2 o 3 años bastante..

Y la delantera depende de todos los lios que hay.. Si se va Aguero, independientemente del que venga, perdemos nivel.. Si se va Forlán que, aunque espero que lo haga, perderiamos gol... Y no se que pasará al final con Adrian... Pero una delantera con Juanfran, Salvio, Reyes, Adrian y Aguero.. Salvo por Juanfran, me gusta.. Claro que que posibilidades hay de que esto pase? MUY POCAS...


No soy pesimista (Y estoy seguro de que aquí te dirán de mi lo contrario), es simplemente que los fichajes son mediocres, a la altura de lo que estamos haciendo habitualmente... Fichar medianias... Ya te digo que el único que Ilusiona es Adrian y todavía no está fichado y Salvio que puede aportar cositas... Lo demás es regular o malo...

A mi me ilusiona más el fichaje de Silvio y el posible regreso de Tiago que lo de Adrian.
Por otro lado,creo que has sido bastante exagerado en la valoración del centro del campo que, si bien es cierto que no tiene el nivel que deberia un Atlético de Madrid,también lo es que mejora a la inmensaria mayoria de la liga,siendo parejo al de Sevilla y Valencia e inferior al de Villareal.
Metropolitano
Metropolitano
Su Campechana Majestad

Mensajes : 19867
Edad : 45
Localización : Madrid
Debut oficial : 14/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Metropolitano el Mar 12 Jul 2011 - 20:17

deyvid_atletico escribió:
Metropolitano escribió:


No es visión negativa... Es que, por ejemplo, decir que Miranda mejora a Godín es demasiado "optimismo"...

El centro del campo con Elias, Tiago, Gabi, Koke y M. Suarez me parece digno de un equipo "malillo" de la Liga.. De hecho si me pongo a comparar probablemente estemos entre los 8 peores centros del campo de la Liga.. El único que pone calidad es Koke (que todavía es muy joven para que se note) y Tiago a medias.. Estamos muy lejos del de los equipos que competimos (Villareal, Sevilla.. Incluso Athetic y Málaga, que ya se unen a este carro). Y no sabes lo jodido que es para un seguidor del Atleti decir que su rival es el Málaga... YA ME CONTARÁS... El centro del campo es la demarcación que más influencia tiene en un equipo de futbol... El pilar básico.. Y este centro del campo NO NOS SUJETA... Para nada...

Yo en la portería no tengo ninguna duda... tenemos dos porteros buenos.

La defensa es buena (Si no se va Godín), aqui si hemos progresado en comparación con hace 2 o 3 años bastante..

Y la delantera depende de todos los lios que hay.. Si se va Aguero, independientemente del que venga, perdemos nivel.. Si se va Forlán que, aunque espero que lo haga, perderiamos gol... Y no se que pasará al final con Adrian... Pero una delantera con Juanfran, Salvio, Reyes, Adrian y Aguero.. Salvo por Juanfran, me gusta.. Claro que que posibilidades hay de que esto pase? MUY POCAS...


No soy pesimista (Y estoy seguro de que aquí te dirán de mi lo contrario), es simplemente que los fichajes son mediocres, a la altura de lo que estamos haciendo habitualmente... Fichar medianias... Ya te digo que el único que Ilusiona es Adrian y todavía no está fichado y Salvio que puede aportar cositas... Lo demás es regular o malo...

A mi me ilusiona más el fichaje de Silvio y el posible regreso de Tiago que lo de Adrian.
Por otro lado,creo que has sido bastante exagerado en la valoración del centro del campo que, si bien es cierto que no tiene el nivel que deberia un Atlético de Madrid,también lo es que mejora a la inmensaria mayoria de la liga,siendo parejo al de Sevilla y Valencia e inferior al de Villareal.

Si claro... Banega, Topal, Tino Costa, Albelda, Parejo a mi me suenan bastante mejor que los nuestros... De hecho son todos internacionales absolutos varias veces (Escepto Parejo)... Cosa que no se puede decir de los nuestros.. Salvo Tiago, y creo que Elias (Aunque no se si debutó) el resto no han pisado nunca una selección absoluta, ni han ido convocados... Grandisimos centrocampistas tenemos... No me jodas...


Y los del Sevilla??? Sabes que el Sevilla a fichado a Trochowski (31 veces internacional con Alemania y 27 años) y, sobre todo a Gary Medel (23 años, 28 veces internacional por chile), que es un jugadorazo.. Un centrocampista defensivo que además mete goles... Es una máquina el chaval este.. Y luego Rakitic.. EL SEVILLA NOS DA MIL VUELTAS EN EL CENTRO DEL CAMPO.... TÍO. Pero mil vueltas... Y siguen los Romaric etc, que son como los nuestros.. trotones... PEro estos 3 de arriba son bastante buenos, bastante mejores que lo que tenemos...

De Villareal ni hablo que me deprimo...

Pero es que el Athetic tiene a Javi Martinez y a Ander Herrera, que para mi son mejor que lo que tenemos.. Es que el Malaga tiene a Toulalan y pretende a Snaijder.. Si me pongo a repasar, como centro del campo tenemos al décimo o al duodécimo de la Liga.. No te engañes... Raul García se ha quedado en lo que se ha quedado.. Mario Suarez es un jugador MUY NORMALITO, Koke es bueno pero MUY JOVEN, Fran Mérida veremos a donde va y Tiago, todavía no está fichado, y aunque lo fichen es evidente que está en declive físico... No te engañes macho... Comparar esto con lo de Villareal y Sevilla es INSOSTENIBLE y con el Valencia tampoco tiene por donde agarrarse... Los del Athletic van para arriba.. y lo del Málaga, si viene Snaijder o Pastore ya me contarás... Es decir, que ya somos de facto el septimo, y eso sin repasar los demás equipos...
deyvid_atletico
deyvid_atletico
Cruciquito
Cruciquito

Mensajes : 28756
Debut oficial : 13/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por deyvid_atletico el Miér 13 Jul 2011 - 0:11

El centro del campo del Sevilla me parece bastante mediocre,exceptuando a Rakitic.Yo no estoy contento con nuestro centro del campo,pero no veo muy superior al de Sevilla,Valencia o Athletic.
Metropolitano
Metropolitano
Su Campechana Majestad

Mensajes : 19867
Edad : 45
Localización : Madrid
Debut oficial : 14/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Metropolitano el Miér 13 Jul 2011 - 7:11

deyvid_atletico escribió:El centro del campo del Sevilla me parece bastante mediocre,exceptuando a Rakitic.Yo no estoy contento con nuestro centro del campo,pero no veo muy superior al de Sevilla,Valencia o Athletic.

Trochowski y Medel no existen no? Son mejores que Rakitic, cada uno en lo suyo... No tiene comparación posible con el nuestro, creeme... Medel es muchisimo mejor que Assunçao, Mario Suarez y todo el que quieras poner de medio defensivo.. Y Trochowski es bastante mejor que cualquiera de nuestros medios centro incluido Tiago... Y no tenemos nada parecido a Rakitic..

Nos dan mil vueltas en el medio campo macho... Lo demás es tener pajaritos en la cabeza...
Don limpio
Don limpio
Cruciquense

Mensajes : 32811
Localización : En tu armario de la limpieza
Debut oficial : 28/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Don limpio el Miér 13 Jul 2011 - 12:38

Metropolitano escribió:
deyvid_atletico escribió:El centro del campo del Sevilla me parece bastante mediocre,exceptuando a Rakitic.Yo no estoy contento con nuestro centro del campo,pero no veo muy superior al de Sevilla,Valencia o Athletic.

Trochowski y Medel no existen no? Son mejores que Rakitic, cada uno en lo suyo... No tiene comparación posible con el nuestro, creeme... Medel es muchisimo mejor que Assunçao, Mario Suarez y todo el que quieras poner de medio defensivo.. Y Trochowski es bastante mejor que cualquiera de nuestros medios centro incluido Tiago... Y no tenemos nada parecido a Rakitic..

Nos dan mil vueltas en el medio campo macho... Lo demás es tener pajaritos en la cabeza...
Es que el centro del campo del Atletico es de los peores de primera. Solo Koke es bueno, y tampoco es un crack. El resto, salvo algun mediocre como Suarez, son muy malos.
JoGv2.0
JoGv2.0
Cruciquense

Mensajes : 37939
Edad : 37
Debut oficial : 26/03/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por JoGv2.0 el Miér 13 Jul 2011 - 12:57

Assunçao ya se ha vendido?

Medel me parece un jugador más contundente y de más recorrido que Elias ( que no es ese perfil por otra parte ) y Mario Suarez ( aunque este tiene mas criterio con el balón y sin el ofensivamente ).

Trochowsky, sinceramente, no me parece mejor jugador que Tiago, y desde luego no me parece una apuesta mejor, a medio plazo, que Koke.

Rakitic si me parece un valor más seguro que Merida y que Elias ( que tampoco es totalmente ese perfil ).

El problema ( o lo contrario según quiera el entrenador ) es que teneis mucho perfil mixto. Mario, Tiago y Elias no son grandes recuperadores ni grandes organizadores ni grandes llegadores, pero si son buenos jugadores en conjunto, y aportan en cada uno de esos aspectos. Yo preferiría tener solo dos de este tipo y quedarme con Koke y otro para un tercer medio y con alguien ( que no creo tengais ahora ) y otro alguien para un primer medio.

Si se va Agüero y vais a por Rossi, quizás Bruno sería buena opción para ese cierre, y tirar con un Bruno-Tiago-Koke. O Canales y un cierre de la liga francesa. No se, hay muchas variantes.

Lo que no puedo entender es que los dis-rigentes que tenéis ahí prefieran directamente no hacer movimientos, aunque esos movimientos no implicasen un gasto neto*

* Que se puede sacar por Raul García y por Elias o Mario? Y cuanto puede costar un buen negrito de cierre de los que hay a patadas en la Ligue 1? No se, coñe, que ya tienen ahí casi 45 kilos con DeGea+Salvio. Me parece ridículo. Como no habéis quemado las oficinas del club aún?
Metropolitano
Metropolitano
Su Campechana Majestad

Mensajes : 19867
Edad : 45
Localización : Madrid
Debut oficial : 14/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Metropolitano el Miér 13 Jul 2011 - 15:36

JoGv2.0 escribió:Assunçao ya se ha vendido?

Medel me parece un jugador más contundente y de más recorrido que Elias ( que no es ese perfil por otra parte ) y Mario Suarez ( aunque este tiene mas criterio con el balón y sin el ofensivamente ).
Medel y Elias no tienen nada que ver.. Medel es un Medio Defensivo de los bajitos, pesados, pegajosos y que llegan a todo.. Pero además es que cuando llega (Y llega mucho porque tiene mucha movilidad y recorrido) hace bastante daño... Yo le he visto meter un gol de chilena.. Además, es un jugador con cierta salida de balón limpia... hoy en día a años luz de Mario Suarez o a Assunçao (No se a que te refieres con el criterio con el balón de Mario Suarez... Cuanto le has visto jugar?)


Trochowsky, sinceramente, no me parece mejor jugador que Tiago, y desde luego no me parece una apuesta mejor, a medio plazo, que Koke.
La segunda parte de la frase es una posibilidad (Aunque creo que alta, porque Koke tiene bastante futbol).. Pero la primera es que desconoces lo que Tiago viene aportando y el bajon físico que esta´arrastrando de un tiempo a esta parte... Yo, si no se aclara YA..PERO YA su fichaje, no me lo traigo.... Se pierde otra pretemporada y nos vuelve a hacer medio año MEDIOCRE... Trochowsky está en su mejor momento físico y técnico y creo que está a mejor nivel que el portugues, siendo similares, creo que está mejor y hará mejor temporada...


Rakitic si me parece un valor más seguro que Merida y que Elias ( que tampoco es totalmente ese perfil ).
Raquitic se parece a lo que teniamos (Jurado) pero que ya no tenemos..

El problema ( o lo contrario según quiera el entrenador ) es que teneis mucho perfil mixto. Mario, Tiago y Elias no son grandes recuperadores ni grandes organizadores ni grandes llegadores, pero si son buenos jugadores en conjunto, y aportan en cada uno de esos aspectos. Yo preferiría tener solo dos de este tipo y quedarme con Koke y otro para un tercer medio y con alguien ( que no creo tengais ahora ) y otro alguien para un primer medio.

Si se va Agüero y vais a por Rossi, quizás Bruno sería buena opción para ese cierre, y tirar con un Bruno-Tiago-Koke. O Canales y un cierre de la liga francesa. No se, hay muchas variantes.

Lo que no puedo entender es que los dis-rigentes que tenéis ahí prefieran directamente no hacer movimientos, aunque esos movimientos no implicasen un gasto neto*

* Que se puede sacar por Raul García y por Elias o Mario? Y cuanto puede costar un buen negrito de cierre de los que hay a patadas en la Ligue 1? No se, coñe, que ya tienen ahí casi 45 kilos con DeGea+Salvio. Me parece ridículo. Como no habéis quemado las oficinas del club aún?
deyvid_atletico
deyvid_atletico
Cruciquito
Cruciquito

Mensajes : 28756
Debut oficial : 13/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por deyvid_atletico el Miér 13 Jul 2011 - 17:44

Metropolitano escribió:
JoGv2.0 escribió:Assunçao ya se ha vendido?

Medel me parece un jugador más contundente y de más recorrido que Elias ( que no es ese perfil por otra parte ) y Mario Suarez ( aunque este tiene mas criterio con el balón y sin el ofensivamente ).
Medel y Elias no tienen nada que ver.. Medel es un Medio Defensivo de los bajitos, pesados, pegajosos y que llegan a todo.. Pero además es que cuando llega (Y llega mucho porque tiene mucha movilidad y recorrido) hace bastante daño... Yo le he visto meter un gol de chilena.. Además, es un jugador con cierta salida de balón limpia... hoy en día a años luz de Mario Suarez o a Assunçao (No se a que te refieres con el criterio con el balón de Mario Suarez... Cuanto le has visto jugar?)


Trochowsky, sinceramente, no me parece mejor jugador que Tiago, y desde luego no me parece una apuesta mejor, a medio plazo, que Koke.
La segunda parte de la frase es una posibilidad (Aunque creo que alta, porque Koke tiene bastante futbol).. Pero la primera es que desconoces lo que Tiago viene aportando y el bajon físico que esta´arrastrando de un tiempo a esta parte... Yo, si no se aclara YA..PERO YA su fichaje, no me lo traigo.... Se pierde otra pretemporada y nos vuelve a hacer medio año MEDIOCRE... Trochowsky está en su mejor momento físico y técnico y creo que está a mejor nivel que el portugues, siendo similares, creo que está mejor y hará mejor temporada...


Rakitic si me parece un valor más seguro que Merida y que Elias ( que tampoco es totalmente ese perfil ).
Raquitic se parece a lo que teniamos (Jurado) pero que ya no tenemos..

El problema ( o lo contrario según quiera el entrenador ) es que teneis mucho perfil mixto. Mario, Tiago y Elias no son grandes recuperadores ni grandes organizadores ni grandes llegadores, pero si son buenos jugadores en conjunto, y aportan en cada uno de esos aspectos. Yo preferiría tener solo dos de este tipo y quedarme con Koke y otro para un tercer medio y con alguien ( que no creo tengais ahora ) y otro alguien para un primer medio.

Si se va Agüero y vais a por Rossi, quizás Bruno sería buena opción para ese cierre, y tirar con un Bruno-Tiago-Koke. O Canales y un cierre de la liga francesa. No se, hay muchas variantes.

Lo que no puedo entender es que los dis-rigentes que tenéis ahí prefieran directamente no hacer movimientos, aunque esos movimientos no implicasen un gasto neto*

* Que se puede sacar por Raul García y por Elias o Mario? Y cuanto puede costar un buen negrito de cierre de los que hay a patadas en la Ligue 1? No se, coñe, que ya tienen ahí casi 45 kilos con DeGea+Salvio. Me parece ridículo. Como no habéis quemado las oficinas del club aún?

1-Creo que has visto poco o nada a Medel,que es un jugador bastante parecido a Assunçao pero con más fuerza y rigor tactico.Tecnicamente es un cero a la izquierda y no tiene llegada en absoluto.Mario Suarez es infinitamente mejor dando salida de balón y Elias es infinitamente mejor llegando a porteria.
2-Tochoski no le llega a Tiago a la suela de los zapatos,ni en la peor versión del Portugues (comienzo de la temporada pasada).
3- Merida podria asemejarse a Rakitic,pero por falta de oportunidades o verdadero nivel,está bastante lejos de el.Tan solo Rakitic veo que puedar ser algo mejor de lo que tenemos nosotros.
Metropolitano
Metropolitano
Su Campechana Majestad

Mensajes : 19867
Edad : 45
Localización : Madrid
Debut oficial : 14/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Metropolitano el Jue 14 Jul 2011 - 1:22

deyvid_atletico escribió:
1-Creo que has visto poco o nada a Medel,que es un jugador bastante parecido a Assunçao pero con más fuerza y rigor tactico.Tecnicamente es un cero a la izquierda y no tiene llegada en absoluto.Mario Suarez es infinitamente mejor dando salida de balón y Elias es infinitamente mejor llegando a porteria.
2-Tochoski no le llega a Tiago a la suela de los zapatos,ni en la peor versión del Portugues (comienzo de la temporada pasada).
3- Merida podria asemejarse a Rakitic,pero por falta de oportunidades o verdadero nivel,está bastante lejos de el.Tan solo Rakitic veo que puedar ser algo mejor de lo que tenemos nosotros.

He visto a Medel 2 partidos enteros.. Y si quieres puedes verle ahora en la copa America.

- Para no tener llegada, me asombra que sea un jugador que ha marcado 18 goles en 121 partidos (siendo medio centro.. Esto ni nuestro querido Vizcaino) y que en uno de los partidos que le vi marco un gol de chilena y el otro te lo cuento ahora... Cuando veas a MArio Suarez o a Assunçao marcar un gol de chilena (exige físico, coordinación y técnica), entonces empiezas a comparar..

- Para ser un cero a la izquierda técnicamente el 2º gol que te digo fue un control con el pecho ORIENTADO A SU PIERNA DE DISPARO y la pego seca.. Técnicamente, una ejecución perfecta..

Assunçao se parece a Medel en que curiosamente les suelen llamar a los dos futbolistas... Cuando uno de los dos no lo es (quien será?). Mario Suarez solo es mejor sacando el balón que Assunçao, en toda la Liga Española..... eso es como decir NADA.. Creo que el que no ha visto a Medel nada eres tu tío.. Por cierto, en el mundial jugó con España y lo hizo de central con 171 cm de estatura... No os quiero recordar como defendió chile aquel partido y con uno menos...
deyvid_atletico
deyvid_atletico
Cruciquito
Cruciquito

Mensajes : 28756
Debut oficial : 13/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por deyvid_atletico el Jue 14 Jul 2011 - 1:33

Metropolitano escribió:
deyvid_atletico escribió:
1-Creo que has visto poco o nada a Medel,que es un jugador bastante parecido a Assunçao pero con más fuerza y rigor tactico.Tecnicamente es un cero a la izquierda y no tiene llegada en absoluto.Mario Suarez es infinitamente mejor dando salida de balón y Elias es infinitamente mejor llegando a porteria.
2-Tochoski no le llega a Tiago a la suela de los zapatos,ni en la peor versión del Portugues (comienzo de la temporada pasada).
3- Merida podria asemejarse a Rakitic,pero por falta de oportunidades o verdadero nivel,está bastante lejos de el.Tan solo Rakitic veo que puedar ser algo mejor de lo que tenemos nosotros.

He visto a Medel 2 partidos enteros.. Y si quieres puedes verle ahora en la copa America.

Dos partidos,no hace falta decir nada más.

- Para no tener llegada, me asombra que sea un jugador que ha marcado 18 goles en 121 partidos (siendo medio centro.. Esto ni nuestro querido Vizcaino) y que en uno de los partidos que le vi marco un gol de chilena y el otro te lo cuento ahora... Cuando veas a MArio Suarez o a Assunçao marcar un gol de chilena (exige físico, coordinación y técnica), entonces empiezas a comparar..

18 goles en 121 partidos!!!! GUUUUUUUUUAUUUUUUUUU
Donde los ha marcado?? Ante quien??
Cleber Santana marcó uno de los mejores goles de la liga a uno de los mejores equipos en su estadio.Espero que ésto también cuente para tu valoración sobre Cleber.
Cuando Medel tenga la mitad de partidos que Mario Suarez en la liga Española lo comenzamos a comparar.


- Para ser un cero a la izquierda técnicamente el 2º gol que te digo fue un control con el pecho ORIENTADO A SU PIERNA DE DISPARO y la pego seca.. Técnicamente, una ejecución perfecta..

El de Cleber fué una ejecución perfecta que combinó regate y disparo.
También recuerdo un golazo de un tal Mikel Lasa (tarugo entre tarugos) desde su propio campo con un golpeo y una ejecución perfecta.


Assunçao se parece a Medel en que curiosamente les suelen llamar a los dos futbolistas... Cuando uno de los dos no lo es (quien será?). Mario Suarez solo es mejor sacando el balón que Assunçao, en toda la Liga Española..... eso es como decir NADA.. Creo que el que no ha visto a Medel nada eres tu tío.. Por cierto, en el mundial jugó con España y lo hizo de central con 171 cm de estatura... No os quiero recordar como defendió chile aquel partido y con uno menos...

Tu obsesión con Mario Suarez es casi tan enfermiza como la de elperla con Alonso.
Llevo bastantes años leyendote y eres bastante tozudo,ya cambiarás de opinion..............O NO.
Aún recordamos tus defensas al Ballack de Osasuna,aunque al menos a el le habias/has visto más de dos partidos.
JoGv2.0
JoGv2.0
Cruciquense

Mensajes : 37939
Edad : 37
Debut oficial : 26/03/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por JoGv2.0 el Jue 14 Jul 2011 - 10:26

Metropolitano escribió:
JoGv2.0 escribió:Assunçao ya se ha vendido?

Medel me parece un jugador más contundente y de más recorrido que Elias ( que no es ese perfil por otra parte ) y Mario Suarez ( aunque este tiene mas criterio con el balón y sin el ofensivamente ).
Medel y Elias no tienen nada que ver.. Medel es un Medio Defensivo de los bajitos, pesados, pegajosos y que llegan a todo.. Pero además es que cuando llega (Y llega mucho porque tiene mucha movilidad y recorrido) hace bastante daño... Yo le he visto meter un gol de chilena.. Además, es un jugador con cierta salida de balón limpia... hoy en día a años luz de Mario Suarez o a Assunçao (No se a que te refieres con el criterio con el balón de Mario Suarez... Cuanto le has visto jugar?)


Trochowsky, sinceramente, no me parece mejor jugador que Tiago, y desde luego no me parece una apuesta mejor, a medio plazo, que Koke.
La segunda parte de la frase es una posibilidad (Aunque creo que alta, porque Koke tiene bastante futbol).. Pero la primera es que desconoces lo que Tiago viene aportando y el bajon físico que esta´arrastrando de un tiempo a esta parte... Yo, si no se aclara YA..PERO YA su fichaje, no me lo traigo.... Se pierde otra pretemporada y nos vuelve a hacer medio año MEDIOCRE... Trochowsky está en su mejor momento físico y técnico y creo que está a mejor nivel que el portugues, siendo similares, creo que está mejor y hará mejor temporada...


Rakitic si me parece un valor más seguro que Merida y que Elias ( que tampoco es totalmente ese perfil ).
Raquitic se parece a lo que teniamos (Jurado) pero que ya no tenemos..

El problema ( o lo contrario según quiera el entrenador ) es que teneis mucho perfil mixto. Mario, Tiago y Elias no son grandes recuperadores ni grandes organizadores ni grandes llegadores, pero si son buenos jugadores en conjunto, y aportan en cada uno de esos aspectos. Yo preferiría tener solo dos de este tipo y quedarme con Koke y otro para un tercer medio y con alguien ( que no creo tengais ahora ) y otro alguien para un primer medio.

Si se va Agüero y vais a por Rossi, quizás Bruno sería buena opción para ese cierre, y tirar con un Bruno-Tiago-Koke. O Canales y un cierre de la liga francesa. No se, hay muchas variantes.

Lo que no puedo entender es que los dis-rigentes que tenéis ahí prefieran directamente no hacer movimientos, aunque esos movimientos no implicasen un gasto neto*

* Que se puede sacar por Raul García y por Elias o Mario? Y cuanto puede costar un buen negrito de cierre de los que hay a patadas en la Ligue 1? No se, coñe, que ya tienen ahí casi 45 kilos con DeGea+Salvio. Me parece ridículo. Como no habéis quemado las oficinas del club aún?

Medel es un correcaminos, un marcador sensacional, y un recuperador espectacular ( a veces mas espectacular que efectivo ). Pero no me parece un jugador fiable más allá de darle el balón al compañero libre cercano y desde luego yo no le destinaría a descolgarse y llegar, con lo que tiene el Sevilla por delante. Mario Suarez me parece un jugador mucho más lúcido para distribuir el balón con criterio, en corto y en largo ( claro que Mario Suarez no te puede aguantar defensivamente el medio campo, casi por si solo, como si puede Medel ).

Últimamente no he visto a Tiago, no. Si físicamente ha caído, entonces no digo nada.
Metropolitano
Metropolitano
Su Campechana Majestad

Mensajes : 19867
Edad : 45
Localización : Madrid
Debut oficial : 14/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Metropolitano el Jue 14 Jul 2011 - 15:27

Mario Suarez lucido? con criterio en corto y en largo? Pero tu a que Mario Suarez te refieres? al que juega en el Atleti?

Yo flipo Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 46153 ... Si tenemos al mejor Xavi Alonso y no lo sabiamos...

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 875522 Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 875522 Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 875522
JoGv2.0
JoGv2.0
Cruciquense

Mensajes : 37939
Edad : 37
Debut oficial : 26/03/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por JoGv2.0 el Vie 15 Jul 2011 - 11:13

Metropolitano escribió:Mario Suarez lucido? con criterio en corto y en largo? Pero tu a que Mario Suarez te refieres? al que juega en el Atleti?

Yo flipo Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 46153 ... Si tenemos al mejor Xavi Alonso y no lo sabiamos...

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 875522 Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 875522 Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 875522

En comparación con Medel, sí.

Tampoco Xabi sabe que su nombre se escribe con "v".

JoGv2.0
JoGv2.0
Cruciquense

Mensajes : 37939
Edad : 37
Debut oficial : 26/03/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por JoGv2.0 el Vie 15 Jul 2011 - 11:13

De todas maneras, mucho hablar de respeto a las opiniones de otros y luego mira como vacilamos..

Twisted Evil
avatar
Raifol
Paquete infumable
Paquete infumable

Mensajes : 2152
Debut oficial : 10/09/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Raifol el Vie 15 Jul 2011 - 15:45

Este hilo es sobre propaganda y al final acabamos hablando de Raul Gª

http://www.as.com/futbol/articulo/tercio-plantilla-sera-cantera/20110715dasdaiftb_12/Tes

El orgullo de López y la veteranía de Pedro Pablo y Baraja
Por si alguno de todos los canteranos tienen dudas, pueden preguntarle a la voz de la experiencia. Esta campaña se ha unido al cuerpo técnico Rubén Baraja. Formado en el Atlético, tras conseguir éxitos en el Valencia, ha vuelto para echar una mano. Incluso la responsabilidad del delegado descansa sobre los hombros de un canterano.

En la actual plantilla el canterano más veterano es Antonio López, quien aseguró a AS: "Como capitán estoy orgulloso de ver en el Atlético de Madrid tanta gente de la cantera. Y cuantos más haya, mejor para el equipo". Muchos creen que el papel de Antonio López en el equipo es tan importante fuera del terreno de juego como dentro. El Atlético tira de canteranos.


http://www.as.com/opinion/articulo/gente-joven-preparada-atletica/20110715dasdaiopi_5/Tes

Manzano está dispuesto a confiar en la gente joven. Muchos de ellos de la casa, lo que demanda la hinchada. (...) Pero están preparados, tienen hambre, ganas y son atléticos. El club apuesta por ellos. Démosles confianza.
Metropolitano
Metropolitano
Su Campechana Majestad

Mensajes : 19867
Edad : 45
Localización : Madrid
Debut oficial : 14/04/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Metropolitano el Vie 15 Jul 2011 - 18:40

JoGv2.0 escribió:De todas maneras, mucho hablar de respeto a las opiniones de otros y luego mira como vacilamos..

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 795127

No vacilo hombre.. Solo es mi forma de ser vehemente.. Admito que he visto poco a Medel, solo en el partido de España y en otro más.. Pero es que no cuela la comparación con Mario Suarez por ningún sitio.. Medel no puede ser peor que Mario Suarez en el desplazamiento ni en corto ni en largo, porque no sería internacional... Dicho de otra manera.. hay que ser muy malo, para ser jugador de primera dibisión y ser peor que Mario Suarez pasando balones... hay jugadores, si, porque hay mucho paquete por el mundo.. Pero poner al bueno de Mario como un jugador que mejora en el desplazamiento a otro es demasiado castigo...
avatar
Raifol
Paquete infumable
Paquete infumable

Mensajes : 2152
Debut oficial : 10/09/2008

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Raifol el Dom 17 Jul 2011 - 14:56

http://www.as.com/futbol/articulo/fomento-puede-iniciar-construccion-estadio/20110717dasdaiftb_39/Tes

En el documento firmado figura que el Atlético se irá a jugar allí en la temporada 2014-15.

El precio del estadio es de 276 millones de euros. De ellos, 218 suponen el coste de las obras y 41 son de la compra de la parcela donde está situado el estadio

Desde el club entienden que la firma con Fomento del pasado 30 de junio es el último paso que faltaba para ver cumplido el sueño de jugar en un estadio con más capacidad (70.000 espectadores), con plazas de aparcamiento y zonas vips propias de un club como el Atlético.

Fomento tiene ya el OK para comenzar las obras.

Contenido patrocinado

Hilo de la propaganda (F.Javier Díaz aka Picu & Cía) - Página 3 Empty Re: Hilo de la propaganda (F.Javier Díaz aka Picu & Cía)

Mensaje por Contenido patrocinado


    Fecha y hora actual: Vie 19 Jul 2019 - 4:21